Πασχάλης Αρβανιτίδης

Από τη Φρικηπαίδεια, την ελεύθερη παρωδία

Μετάβαση σε: πλοήγηση, αναζήτηση
Bwikilogo
Για τους σοβαροφανείς υπάρχει σχετικό άρθρο στη Βικιπαίδεια για τον μασκαρά.

Διάσημος αοιδός που έδρασε κατά κύριο λόγο στα 60's. Εγινε γνωστός με τον metal ύμνο "όταν πηγαίναμε μαζί σχολείο" ενώ στη συνέχεια πειραματίστηκε με τις δυνατότητες της punk και της rap-metal διασκευάζοντας το "she's got it!" σε "σε λένε! (το κόρίτσι του Μάη)". Αποθέωση της τραγουδιστικής του καριέρας ήταν το ποιητικό-υπαρξιακό τραγούδι με πολιτικές προεκτάσεις "ντο φα φα φα σολ φα σολ φα μι ντο σι μι Μιμή ντο σι ντο σι σολ σι ντο" το οποίο σημάδεψε τον 3908ο διαγωνισμό της Γιουροβίζιον. Τα υπόλοιπα τραγούδια του σκονίζονται στο χρονοντούλαπο της ιστορίας.

Είναι παντρεμένος και μέχρι και το τέλος του 2007 είχε επισήμως 2 παιδιά. Άπό το Γενάρη του 2008 όλοι πλέον ξέρουν ότι έχει 3 (παιδιά). Την πληροφορία αυτή αγνοούν η βικιπαίδεια και η σύζυγός του, η οποία εξακολουθεί να μην καταλαβαίνει γιατί δεν χωράει να περάσει κάτω από την πόρτα, γιατί οι φίλοι της τη χρησιμοποιούν και για κρεμάστρα, γιατί πιάνει σήματα από το ραδιόφωνο, τα δορυφορικά κανάλια και τους εξωγήινους και γιατί όταν πάει να χτυπήσει κάποιον οι γύρω της φωνάζουν "χτύπα τον με τα κέρατα!"

Με την ιστορία αυτή, του 3ου παιδιού δηλαδή το λεγόμενο "στιγμιαίο λάθος" που κράτησε κάνα-δυο χρόνια (δεν συμπεριλαμβάνεται ο ΦΠΑ, δηλαδή η εγκυμοσύνη), ο μασκαράς απέκτησε και ιδιαίτερες γνώσεις μοριακής βιολογίας και βιοτεχνολογίας (τεχνολογίες σχετικές με το DNA). γι'αυτό και διαψεύδει όσους λένε ότι το DNA πιστοποιεί, ότι το παιδί είναι δικό του. Και με αυτή τη δικαιολογία θέλει να κάνει ο ίδιος το τεστ DNA, αφού κανείς άλλος δεν ξέρει το DNA καλύτερα από τον ίδιο. Μάλιστα στο σπίτι του έχει έναν πανάκριβο πίνακα που δείχνει κάποια μόρια DNA (παραμένει άγνωστο αν είναι δικά του, ή, του παιδιού που απέκτησε μετά το "στιγμιαίο λάθος"). Επίσης την αυλή του σπιτιού του κοσμεί ένα μεγάλο γλυπτό, που μοιάζει με μόριο DNA τυλιγμένο γύρω από τον εαυτό του.

Dna array

DNA (του_μασκαρά?)

ο περίφημος πίνακας με το DNA στο σπίτι του μασκαρά...
TAGCTGACTGACTAGCTGATGCTCGAGCTGATGCTAGCATGACGGACTGGACTGTAG
GACTGATCGATCGATCGACACATCAGTGTGTCGTAGTCGTGACTGATGCTCGACTGA
TGCTAGTCGTAGCGGTATCGTGCTAGTCGTACAGCATCGTAGCTGATCGTGACTGCT
TAGCTAGCTAGCTGACTTAGCTACGTCGATGCTGACTAGCTGACTAGCTCGATCGAT
(οι 4 βάσεις του DNA...έχω την εντύπωση οτι το'χεσα λιγο)...

μετάφραση:... τίνος είναι τελικά το παιδί?


DNA

το γλυπτό

Το γλυπτό που κοσμεί την αυλή του σπιτιού του μασκαρά...
Απορία του μασκαρά για το γλυπτό:... με τι μοιάζει?... με τι μοιάζει?...